EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:46090876-46091666]
Chromosome characteristics of ZNF274[chr17:46090876-46091666]
Back to top
Enhancers possibly regulated by ZNF274[chr17:46090876-46091666]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 46086719 46098055 enh4449
Brain (SK-N-SH) Brain (SK-N-MC) Prostate (RWPE1) Ovary Bone (Osteoblast) Blood (GM12878) Muscle (A673) Peripheral Blood (MM.1S) Blood (Karpas-422) Spleen Stomach
chr17 46091429 46091644 vista25007
VISTA
SNP sites on ZNF274[chr17:46090876-46091666]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 46091136 rs145655690 C T 4907409
chr17 46091268 rs543315656 AGCTGGGAAACTCTGGTTTCCAAGTCCTCTCTCAGAGGCAACCG A 4907410
chr17 46091277 rs142022194 ACT A 4907411
chr17 46091311 rs553752672 G A 4907412
chr17 46091444 rs1076236 T C 4907413
Genes possibly regulated by ZNF274[chr17:46090876-46091666]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:46090876-46091666]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results