Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 53309329 53318845 enh62626
chr17 53315618 53315983 vista25179

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 53315665 rs536245851 CCCCGCCGCGCCCCTCTCCGCGGGT C 4938035
chr17 53315669 rs552703072 G A 4938036
chr17 53315689 rs571510322 T C 4938037
chr17 53315721 rs536389940 GC G 4938038
chr17 53315781 rs34653675 A C,G 4938039
chr17 53315870 rs558189083 G C,T 4938040
chr17 53315888 rs77638294 C A,T 4938041

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results