EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:63169812-63170278]
Chromosome characteristics of ZNF143[chr17:63169812-63170278]
Back to top
Enhancers possibly regulated by ZNF143[chr17:63169812-63170278]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 63165985 63173006 enh48049
Bone Marrow (K562) Brain (SK-N-SH) Thymus Blood (OCI-LY7) Spleen Blood (T-cell) Stomach
chr17 63169538 63169893 vista25559
VISTA
SNP sites on ZNF143[chr17:63169812-63170278]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 63169814 rs145726652 G A,C 4988788
chr17 63169834 rs16960834 C T 4988789
chr17 63169944 rs547346402 T TGATGAATGAAGAAATG,TGATGAATGAAGAAATGGATGAATGAA,TGATGAATGAAGAAATGGATGAATGAG 4988790
chr17 63169954 rs530624083 A G 4988791
chr17 63170030 rs141229113 G A,C 4988792
chr17 63170128 rs114144558 C T 4988793
Genes possibly regulated by ZNF143[chr17:63169812-63170278]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr17:63169812-63170278]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results