EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:73310003-73312706]
Chromosome characteristics of ZNF143[chr17:73310003-73312706]
Back to top
Enhancers possibly regulated by ZNF143[chr17:73310003-73312706]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 73302368 73312615 enh17374
Liver (HepG2) Large Intestine Esophagus Blood (OCI-LY7) Lung (A549) Blood (GM12878) Stomach Placenta Pancreas Epithelial (MCF-7)
chr17 73309965 73310187 vista25970
VISTA
chr17 73312070 73312303 vista25971
VISTA
SNP sites on ZNF143[chr17:73310003-73312706]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 73310008 rs569411709 T C 5055520
chr17 73310061 rs150480418 C A 5055521
chr17 73310264 rs59568284 G A 5055522
chr17 73310332 rs535602733 C T 5055523
chr17 73310361 rs116176099 C T 5055524
chr17 73310490 rs9897815 C T 5055525
chr17 73310510 rs575766879 G A,T 5055526
chr17 73310534 rs149458203 G A 5055527
chr17 73310573 rs6501775 C T 5055528
chr17 73310629 rs398031608 TA T 5055529
chr17 73310629 rs5822082 TA T 5055530
chr17 73310651 rs188966807 A C 5055531
chr17 73310656 rs181691873 C G 5055532
chr17 73310710 rs190798397 C T 5055533
chr17 73310711 rs11867792 G C 5055534
chr17 73310719 rs567726216 G C 5055535
chr17 73310739 rs577970314 C T 5055536
chr17 73310745 rs548880099 G A 5055537
chr17 73310751 rs529012498 A AC 5055538
chr17 73310756 rs566994630 A G 5055539
chr17 73310770 rs537742821 T C 5055540
chr17 73310772 rs182136522 C A 5055541
chr17 73310795 rs577521367 C T 5055542
chr17 73310800 rs185920308 G A 5055543
chr17 73310811 rs2385212 G C 5055544
chr17 73310847 rs528005701 C T 5055545
chr17 73310859 rs529591833 G A 5055546
chr17 73310920 rs56370090 GAA G 5055547
chr17 73310920 rs796714884 GAA G 5055548
chr17 73310999 rs181090442 G A 5055549
chr17 73311131 rs573336068 A T 5055550
chr17 73311155 rs556220055 C T 5055551
chr17 73311171 rs397935741 C CT 5055552
chr17 73311171 rs557517528 C CT 5055553
chr17 73311171 rs56379038 C CT 5055554
chr17 73311232 rs541778263 C T 5055555
chr17 73311256 rs112860494 C T 5055556
chr17 73311301 rs183015130 T C 5055557
chr17 73311462 rs188751136 G C 5055558
chr17 73311544 rs571138858 G A 5055559
chr17 73311727 rs139289909 G A 5055560
chr17 73311749 rs144172543 A C 5055561
chr17 73311770 rs56311401 G A 5055562
chr17 73311827 rs150588831 C T 5055563
chr17 73311857 rs534030321 G A 5055564
chr17 73311860 rs541739858 A G 5055565
chr17 73311898 rs139598670 C T 5055566
chr17 73312021 rs555801954 C G 5055567
chr17 73312040 rs149986291 G A 5055568
chr17 73312171 rs11410664 A AT 5055569
chr17 73312184 rs8072449 G A 5055570
chr17 73312189 rs527437603 G A 5055571
chr17 73312272 rs8081778 T C 5055572
chr17 73312328 rs60481995 C A,T 5055573
chr17 73312357 rs114044024 C T 5055574
chr17 73312416 rs565785521 T A 5055575
chr17 73312473 rs528572246 A AGGTGCAGTAGCGTATGCCTGTAGTCCCAGCTACTTG 5055576
chr17 73312473 rs71159484 A AGGTGCAGTAGCGTATGCCTGTAGTCCCAGCTACTTG 5055577
chr17 73312473 rs869101969 A AGGTGCAGTAGCGTATGCCTGTAGTCCCAGCTACTTG 5055578
chr17 73312574 rs11869175 G C 5055579
chr17 73312672 rs554180624 G C 5055580
Genes possibly regulated by ZNF143[chr17:73310003-73312706]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr17:73310003-73312706]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results