Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 77780565 77806815 enh4626
chr17 77803693 77803802 vista26288

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 77802967 rs9914360 T C 5097160
chr17 77802968 rs9902362 G T 5097161
chr17 77802989 rs563093550 C T 5097162
chr17 77803011 rs72846510 C T 5097163
chr17 77803087 rs561011213 G A 5097164
chr17 77803190 rs72846512 G A 5097165
chr17 77803270 rs9903026 G A 5097166
chr17 77803272 rs575674359 GCTTTAGAGAGGGGGAGAGGGGTCAGGAGAGTT G 5097167
chr17 77803540 rs199529851 C T 5097168
chr17 77803859 rs577668276 C G 5097169
chr17 77803881 rs114134504 C T 5097170
chr17 77803896 rs186210814 T A 5097171
chr17 77803897 rs190714836 C A 5097172
chr17 77804000 rs77277391 G A 5097173
chr17 77804030 rs546983486 T A 5097174
chr17 77804151 rs74775947 A C 5097175
chr17 77804163 rs551127923 A G 5097176
chr17 77804194 rs115382341 G A 5097177

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results