Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 81027945 81032095 enh109792
chr17 81031472 81031760 vista26501

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 81030846 rs79715887 G A,C 5127358
chr17 81030858 rs79899930 G A 5127359
chr17 81030862 rs58919863 T C 5127360
chr17 81030868 rs145813348 C A 5127361
chr17 81030906 rs75562617 G A 5127362
chr17 81030941 rs116620802 C T 5127363
chr17 81030988 rs143128649 CGCCTTCACTTGCTCGGGCCCCACCCCGCTGG C 5127364
chr17 81030988 rs58581836 CGCCTTCACTTGCTCGGGCCCCACCCCGCTGG C 5127365
chr17 81031013 rs561022404 C T 5127366
chr17 81031041 rs11654537 T C 5127367
chr17 81031131 rs7359600 C T 5127368
chr17 81031203 rs528661081 A C 5127369
chr17 81031294 rs78131074 T G 5127370
chr17 81031385 rs147382345 G A 5127371

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results