Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 81027945 81032095 enh109792
chr17 81031472 81031760 vista26501

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 81030988 rs143128649 CGCCTTCACTTGCTCGGGCCCCACCCCGCTGG C 5127364
chr17 81030988 rs58581836 CGCCTTCACTTGCTCGGGCCCCACCCCGCTGG C 5127365
chr17 81031013 rs561022404 C T 5127366
chr17 81031041 rs11654537 T C 5127367
chr17 81031131 rs7359600 C T 5127368
chr17 81031203 rs528661081 A C 5127369
chr17 81031294 rs78131074 T G 5127370
chr17 81031385 rs147382345 G A 5127371
chr17 81031678 rs556112077 C T 5127372
chr17 81031702 rs77935027 C T 5127373
chr17 81031768 rs8072895 G A 5127374
chr17 81031819 rs80089449 G C 5127375
chr17 81031897 rs569582826 C A 5127376
chr17 81032182 rs4986077 C T 5127377

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results