Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 81035965 81050038 enh17462
chr17 81038687 81040054 vista26503

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 81039052 rs562547330 G A 5127468
chr17 81039059 rs543951733 T TG 5127469
chr17 81039062 rs529750153 G A,C,T 5127470
chr17 81039165 rs543392934 C G 5127471
chr17 81039234 rs79964142 A C 5127472
chr17 81039239 rs8068701 C A 5127473
chr17 81039258 rs550686880 G A 5127474
chr17 81039260 rs568978167 G A 5127475
chr17 81039277 rs536272749 C G,T 5127476
chr17 81039530 rs552311766 GAGGGGACCCCCCCACACACACACAC G 5127477
chr17 81039542 rs543201996 CCACA C 5127478
chr17 81039542 rs577939973 C CA 5127479
chr17 81039544 rs8069795 A C,G 5127480

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results