Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 81035965 81050038 enh17462
chr17 81038687 81040054 vista26503

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 81039530 rs552311766 GAGGGGACCCCCCCACACACACACAC G 5127477
chr17 81039542 rs543201996 CCACA C 5127478
chr17 81039542 rs577939973 C CA 5127479
chr17 81039544 rs8069795 A C,G 5127480
chr17 81039561 rs145606529 A AC 5127481
chr17 81039686 rs148889058 TC T 5127482
chr17 81039726 rs144801512 C G 5127483
chr17 81039747 rs148136384 C T 5127484
chr17 81039932 rs146160498 G T 5127485
chr17 81040003 rs552867410 C T 5127486
chr17 81040155 rs535584428 G T 5127487
chr17 81040171 rs140157949 C T 5127488
chr17 81040193 rs58635421 C A 5127489
chr17 81040196 rs564430554 G C 5127490
chr17 81040285 rs529052437 C G 5127491
chr17 81040366 rs139329561 T C 5127492
chr17 81040534 rs140519611 C T 5127493
chr17 81040656 rs144380018 C T 5127494
chr17 81040721 rs189474843 A G 5127495
chr17 81040825 rs373344602 G A 5127496
chr17 81040847 rs7503602 T C 5127497
chr17 81040874 rs143467248 C T 5127498
chr17 81040907 rs11869715 G A 5127499
chr17 81040918 rs150925808 T G 5127500
chr17 81041001 rs569340112 G T 5127501
chr17 81041077 rs6502043 C T 5127502
chr17 81041106 rs181638826 C G,T 5127503
chr17 81041155 rs73360462 C G,T 5127504
chr17 81041180 rs185815124 C A,T 5127505
chr17 81041205 rs140795024 G A 5127506

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results