EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr18:77153091-77154001]
Chromosome characteristics of ZNF143[chr18:77153091-77154001]
Back to top
Enhancers possibly regulated by ZNF143[chr18:77153091-77154001]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 77152945 77158715 enh4939
Uterus Blood (Karpas-422)
chr18 77153646 77154504 vista28035
VISTA
SNP sites on ZNF143[chr18:77153091-77154001]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 77153250 rs544867473 G GGGCGCACCTGCCCCTGGCT 5356986
chr18 77153339 rs62096861 G A 5356987
chr18 77153340 rs7244445 C T 5356988
chr18 77153416 rs147584086 G A 5356989
chr18 77153452 rs116641388 C T 5356990
chr18 77153508 rs188464749 G A 5356991
chr18 77153544 rs397765375 C CA 5356992
chr18 77153544 rs56111064 C CA 5356993
chr18 77153780 rs185536051 G A 5356994
chr18 77153797 rs571297681 G A 5356995
chr18 77153907 rs142036145 C T 5356996
chr18 77153995 rs75298862 C G 5356997
chr18 77153996 rs77258694 G A 5356998
Genes possibly regulated by ZNF143[chr18:77153091-77154001]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr18 77155856 77289325 + NFATC1 ENSG00000131196.13 77155856 0.7 1.0 1855 16684
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF143[chr18:77153091-77154001]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results