EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:570966-573566]
Chromosome characteristics of ZNF274[chr19:570966-573566]
Back to top
Enhancers possibly regulated by ZNF274[chr19:570966-573566]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 570285 574435 enh99529
Uterus
chr19 573434 573573 vista28093
VISTA
SNP sites on ZNF274[chr19:570966-573566]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 571044 rs56014328 A G 5365359
chr19 571090 rs56289989 T G 5365360
chr19 571111 rs142430380 C G 5365361
chr19 571120 rs55674518 C G 5365362
chr19 571297 rs541611995 C G 5365363
chr19 571314 rs111777390 A AGCCCTTCGCGTTCG 5365364
chr19 571314 rs28989768 A AGCCCTTCGCGTTCG 5365365
chr19 571320 rs28989769 T G 5365366
chr19 571361 rs28989770 C A,T 5365367
chr19 571377 rs28989771 C T 5365368
chr19 571397 rs28989772 G A 5365369
chr19 571423 rs56087693 A C,G,T 5365370
chr19 571482 rs189222917 G A 5365371
chr19 571511 rs28915396 G A 5365372
chr19 571513 rs28915397 G A,T 5365373
chr19 571514 rs55881761 C T 5365374
chr19 571633 rs537171122 G T 5365375
chr19 571664 rs576119728 C G 5365376
chr19 571680 rs140918061 C T 5365377
chr19 571770 rs55706133 C A,T 5365378
chr19 571781 rs62132624 T A 5365379
chr19 571883 rs55925524 G A 5365380
chr19 571889 rs28915398 G A,C,T 5365381
chr19 571890 rs55996923 G A,T 5365382
chr19 571924 rs534604742 G A 5365383
chr19 571976 rs28915399 G A 5365384
chr19 572004 rs28915400 G T 5365385
chr19 572086 rs61577385 C CAT 5365386
chr19 572231 rs28915401 G A 5365387
chr19 572288 rs373935886 C G 5365388
chr19 572293 rs28915402 C G 5365389
chr19 572293 rs574482659 CG C 5365390
chr19 572317 rs4919859 G C 5365391
chr19 572345 rs28915403 G A 5365392
chr19 572346 rs542690852 C T 5365393
chr19 572461 rs561149009 C A 5365394
chr19 572528 rs183979701 A C,G 5365395
chr19 572533 rs537163143 G A 5365396
chr19 572583 rs572465381 G GGGC 5365397
chr19 572596 rs28915406 A G 5365398
chr19 572610 rs188657384 G A,T 5365399
chr19 572628 rs12609610 A G,T 5365400
chr19 572632 rs14173 A G 5365401
chr19 572663 rs533301686 G A 5365402
chr19 572680 rs11551906 A G 5365403
chr19 572811 rs28915407 G T 5365404
chr19 572823 rs142683396 G A 5365405
chr19 572860 rs28915408 G A 5365406
chr19 572878 rs2072307 T C 5365407
chr19 572934 rs141476449 TCCGGCCTCGAGC T 5365408
chr19 572934 rs28989773 TCCGGCCTCGAGC T 5365409
chr19 572948 rs563525909 C A,T 5365410
chr19 572988 rs28989774 G A,T 5365411
chr19 572998 rs968506 G C 5365412
chr19 573095 rs538206288 G C 5365413
chr19 573132 rs367873477 T C 5365414
chr19 573145 rs138748626 G T 5365415
chr19 573205 rs2072308 T C 5365416
chr19 573326 rs544661215 C T 5365417
chr19 573405 rs150718850 C A,G 5365418
chr19 573451 rs186158048 C T 5365419
chr19 573497 rs547376405 GTCTTGCCTAGGGCGTGCACCTGCCCCCGGGTGT G 5365420
chr19 573502 rs575145394 G C 5365421
chr19 573522 rs190631157 C T 5365422
chr19 573564 rs568500243 C T 5365423
Genes possibly regulated by ZNF274[chr19:570966-573566]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 571297 583493 + BSG ENSG00000172270.14 571297 0.64 1.0 331 16707
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr19:570966-573566]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results