Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 570285 574435 enh99529
chr19 573434 573573 vista28093

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 572998 rs968506 G C 5365412
chr19 573095 rs538206288 G C 5365413
chr19 573132 rs367873477 T C 5365414
chr19 573145 rs138748626 G T 5365415
chr19 573205 rs2072308 T C 5365416
chr19 573326 rs544661215 C T 5365417
chr19 573405 rs150718850 C A,G 5365418
chr19 573451 rs186158048 C T 5365419
chr19 573497 rs547376405 GTCTTGCCTAGGGCGTGCACCTGCCCCCGGGTGT G 5365420
chr19 573502 rs575145394 G C 5365421
chr19 573522 rs190631157 C T 5365422
chr19 573564 rs568500243 C T 5365423

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results