Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 570285 574435 enh99529
chr19 573434 573573 vista28093

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 573405 rs150718850 C A,G 5365418
chr19 573451 rs186158048 C T 5365419
chr19 573497 rs547376405 GTCTTGCCTAGGGCGTGCACCTGCCCCCGGGTGT G 5365420
chr19 573502 rs575145394 G C 5365421
chr19 573522 rs190631157 C T 5365422
chr19 573564 rs568500243 C T 5365423
chr19 573698 rs28921968 C G 5365424
chr19 573712 rs28921969 AG A 5365425
chr19 573759 rs559190146 G A 5365426
chr19 573777 rs139116476 C G 5365427
chr19 573778 rs117305685 C T 5365428
chr19 573903 rs574712193 T A 5365429
chr19 573967 rs147511542 T C 5365430

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results