EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:1262362-1263410]
Chromosome characteristics of ZNF274[chr19:1262362-1263410]
Back to top
Enhancers possibly regulated by ZNF274[chr19:1262362-1263410]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1257265 1269175 enh4952
Brain (SK-N-SH) Uterus Blood (T-cell) Blood (Karpas-422)
chr19 1262305 1262850 vista28155
VISTA
SNP sites on ZNF274[chr19:1262362-1263410]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1262460 rs147041575 G T 5373973
chr19 1262694 rs534137775 G A 5373974
chr19 1262776 rs76339773 C T 5373975
chr19 1262863 rs150216063 T C 5373976
chr19 1262941 rs10414912 G A 5373977
chr19 1262978 rs10422807 T C 5373978
chr19 1263167 rs11882917 C G 5373979
chr19 1263299 rs968698 A C 5373980
chr19 1263310 rs572016830 C CACCAGATACAAAGAGGGCCCTG 5373981
chr19 1263343 rs575373727 G A 5373982
Genes possibly regulated by ZNF274[chr19:1262362-1263410]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:1262362-1263410]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results