EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr19:2695316-2696081]
Chromosome characteristics of TCF7L2[chr19:2695316-2696081]
Back to top
Enhancers possibly regulated by TCF7L2[chr19:2695316-2696081]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 2691745 2701695 enh60738
Lung Blood (OCI-LY7) Blood (GM12878) Stomach Peripheral Blood (MM.1S) Pancreas Heart
chr19 2695163 2695542 vista28251
VISTA
SNP sites on TCF7L2[chr19:2695316-2696081]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 2695474 rs187510609 C T 5388138
chr19 2695636 rs555781880 C A 5388139
chr19 2695661 rs10402849 C T 5388140
chr19 2695707 rs2159917 A G 5388141
chr19 2695723 rs551452662 G A,C 5388142
chr19 2695875 rs191973307 G A 5388143
chr19 2695922 rs149674301 C T 5388144
chr19 2695956 rs569068443 AGACCAGCCTGGGCAACATGGT A 5388145
chr19 2696008 rs7248619 A C,G 5388146
chr19 2696067 rs149229429 A C 5388147
Genes possibly regulated by TCF7L2[chr19:2695316-2696081]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr19:2695316-2696081]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results