Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5338459 5338816 vista28388

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5338010 rs112772146 G A,C 5408694
chr19 5338113 rs201115332 C CG 5408695
chr19 5338114 rs199658055 C CG 5408696
chr19 5338179 rs34907337 A G 5408697
chr19 5338253 rs75853641 G C 5408698
chr19 5338345 rs561397172 G GTGGCCCCCAGGGGGCTGGGAGGCC 5408699
chr19 5338447 rs140199143 G A,T 5408700

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 5158506 5340814 - PTPRS ENSG00000105426.10 5340814 0.7 1.0 2319 16857


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results