Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5829202 5829624 vista28400

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5828776 rs10775589 G C 5411065
chr19 5828811 rs112836591 TG T 5411066
chr19 5828892 rs113189876 G C 5411067
chr19 5828895 rs778811 G T 5411068
chr19 5828910 rs10853991 A G 5411069
chr19 5828921 rs778810 A G 5411070
chr19 5828939 rs148112183 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411071
chr19 5828939 rs377114531 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411072
chr19 5828939 rs752334055 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411073
chr19 5828939 rs755753379 CCCCAGCGTCTCCCTGTCCGCACTGAT C 5411074
chr19 5829182 rs8100656 A C 5411075
chr19 5829349 rs141960626 T C 5411076
chr19 5829352 rs552518870 A C 5411077
chr19 5829592 rs11666494 A G 5411078
chr19 5829599 rs533643032 C T 5411079
chr19 5829716 rs553716441 G A 5411080

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results