Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 7892300 7907949 enh17898
chr19 7907381 7907869 vista28502

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 7907207 rs565687085 AATGT A 5425319
chr19 7907207 rs567267958 A T 5425320
chr19 7907241 rs140720814 A ATG,ATGTGTATCAAGTGTGTGCATGTGTGTGGGGACGTGTGAATG 5425321
chr19 7907264 rs552932493 G C 5425322
chr19 7907285 rs577895117 TGA T 5425323
chr19 7907341 rs542725434 ATG A 5425324
chr19 7907371 rs573264589 TG T 5425325
chr19 7907398 rs530814767 AGT A 5425326
chr19 7907407 rs563931180 A G 5425327
chr19 7907440 rs559689439 A T 5425328
chr19 7907459 rs551436577 G A 5425329
chr19 7907473 rs186813699 C T 5425330

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results