Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 124605050 124605342 vista42255

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 124605306 rs181372104 G A 7000177
chr3 124605531 rs6438860 C G 7000178
chr3 124605596 rs551883371 GGCGGGGCTGCGCGCGGGGAGCGCCCC G 7000179
chr3 124605718 rs542370871 C T 7000180
chr3 124605736 rs6438861 T C 7000181

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results