Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 2537711 2538436 vista43926

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 2537258 rs144836783 G A 7352801
chr4 2537337 rs114394439 G C 7352802
chr4 2537381 rs200028417 ACGCAAGCCCTTATTTCTGAT A 7352803
chr4 2537443 rs61790194 G A 7352804
chr4 2537473 rs35139572 C T 7352805
chr4 2537613 rs76964113 G A,C 7352806
chr4 2537836 rs536750807 A G 7352807
chr4 2537897 rs536275783 G A 7352808
chr4 2537955 rs552970463 T C 7352809
chr4 2538050 rs575475333 T G 7352810

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results