EnhancerDB
  1. Home
  2. TFBS
  3. CEBPB[chr4:88130937-88131193]
Chromosome characteristics of CEBPB[chr4:88130937-88131193]
Back to top
Enhancers possibly regulated by CEBPB[chr4:88130937-88131193]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr4 88128965 88137012 enh8081
Brain (SK-N-SH) Stomach Muscle (A673) Thyroid Blood (Karpas-422) Pancreas Heart
chr4 88130914 88131113 vista45338
VISTA
SNP sites on CEBPB[chr4:88130937-88131193]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr4 88130992 rs114803236 C T 7670868
chr4 88131000 rs35717106 GT G 7670869
chr4 88131000 rs766193728 GT G 7670870
chr4 88131007 rs572155568 T G 7670871
chr4 88131047 rs201379968 C CCAAGCTGGAGTGCAGTGGCG 7670872
chr4 88131124 rs369227842 G A 7670873
chr4 88131160 rs186295733 C A,T 7670874
Genes possibly regulated by CEBPB[chr4:88130937-88131193]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by CEBPB[chr4:88130937-88131193]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results