Chrom Start End Enhancer ID Tissues that enhancer appears More
chr5 80474805 80493095 enh8531
chr5 80490965 80491330 vista48236

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr5 80490903 rs530658691 C A,T 8341438
chr5 80490946 rs183880722 G C 8341439
chr5 80491017 rs553271877 C CGCGCCAGAGCCAATGCTGACCCGGGA 8341440
chr5 80491022 rs73768036 C T 8341441
chr5 80491100 rs17227806 T C 8341442
chr5 80491108 rs75069784 C T 8341443

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results