EnhancerDB
  1. Home
  2. TFBS
  3. RELA[chr6:10355515-10355950]
Chromosome characteristics of RELA[chr6:10355515-10355950]
Back to top
Enhancers possibly regulated by RELA[chr6:10355515-10355950]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 10345805 10357875 enh23003
Bone Marrow (K562) Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Pancreas (Panc1) Epithelial (MCF-7)
chr6 10355646 10355875 vista50765
VISTA
SNP sites on RELA[chr6:10355515-10355950]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 10355661 rs150491685 T C 8823048
chr6 10355673 rs137884832 A G 8823049
chr6 10355690 rs73420294 C G,T 8823050
chr6 10355723 rs12190178 G A 8823051
chr6 10355758 rs529682048 T G 8823052
chr6 10355779 rs573346433 T TTGTTTTTCCATTACAGTAACATGCATAGTTCCCA 8823053
Genes possibly regulated by RELA[chr6:10355515-10355950]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RELA[chr6:10355515-10355950]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results