Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 12288471 12288892 vista50901

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 12288546 rs146988956 G A,C,T 8837533
chr6 12288595 rs73722759 C G 8837534
chr6 12288742 rs375405214 GGAGGCCAGGGGCCCCGGCA G 8837535
chr6 12288742 rs71741161 GGAGGCCAGGGGCCCCGGCA G 8837536

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr6 12290596 12297427 + EDN1 ENSG00000078401.6 12290596 0.91 0.93 1813 6163


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results