Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 413685 431255 enh17471

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 417748 rs369510939 GTCATTGCTGTAGCAACTGA G 5130701
chr18 417748 rs376005529 GTCATTGCTGTAGCAACTGA G 5130702

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results