Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 53886505 53895395 enh81410

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 53894262 rs200743186 T TTCTC,TTCTCTCTCTGTCTATCTCTC 5271938
chr18 53894266 rs530063765 C A 5271939
chr18 53894268 rs143488086 C CTCTG 5271940
chr18 53894268 rs369702848 C CTCTG 5271941
chr18 53894272 rs1229589 A C,G 5271942

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results