Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 57060265 57067135 enh17756

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 57066983 rs538651814 CACCCTGGGATCACTTGAGG C 5292481

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results