Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 67947093 67960855 enh4099

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 67958053 rs533400959 AGGACGACTTGAGTCACTTTGGCTTGGG A 4498421
chr16 67958058 rs79327462 G A 4498422

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results