Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1093945 1098095 enh99531

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1095925 rs370550675 ACCAGCCTAGCCTGGGTATCTCC A 5371605
chr19 1095925 rs559701925 ACCAGCCTAGCCTGGGTATCTCC A 5371606

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 1086594 1095598 - POLR2E ENSG00000099817.7 1095598 0.68 1.0 314 16733


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results