Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1257265 1269175 enh4952

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1263310 rs572016830 C CACCAGATACAAAGAGGGCCCTG 5373981

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results