EnhancerDB
  1. Home
  2. TFBS
  3. FOXI1[chr19:1548733-1548745]
Chromosome characteristics of FOXI1[chr19:1548733-1548745]
Back to top
Enhancers possibly regulated by FOXI1[chr19:1548733-1548745]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 1537125 1551004 enh17842
Bone Marrow (K562) Esophagus Placenta Colon (HCT116) Pancreas Uterus
SNP sites on FOXI1[chr19:1548733-1548745]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 1548733 rs144731997 C CAAAT 5376389
chr19 1548733 rs59427502 C CAAAT,CAAATAAATAAAT,CAAATAAATAAATAAATAAATAAAT 5376390
chr19 1548733 rs769232877 C CAAAT 5376391
Genes possibly regulated by FOXI1[chr19:1548733-1548745]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXI1[chr19:1548733-1548745]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results