Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 2691745 2701695 enh60738

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 2695956 rs569068443 AGACCAGCCTGGGCAACATGGT A 5388145

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results