Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5306616 5311786 enh32878

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5307405 rs138260623 ATCTTAGTGTTATGAGATCAGTATC A 5408410

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results