Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5684665 5695835 enh4981

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5694597 rs545493358 AGGTGGGGTGACAGGTGCGGGGT A 5410530

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results