Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 7449182 7454975 enh89920

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 7450329 rs543216462 CATTATTATTATTATTATTATTATT C 5421534
chr19 7450329 rs557675109 CATTA C 5421535

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results