Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 13889645 13898207 enh17933

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 13895853 rs199746933 AGGGCCAGGACGGGGTGGGCTCT A 5451673
chr19 13895853 rs375097383 AGGGCCAGGACGGGGTGGGCTCT A 5451674

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results