EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2A[chr19:14581752-14581767]
Chromosome characteristics of TFAP2A[chr19:14581752-14581767]
Back to top
Enhancers possibly regulated by TFAP2A[chr19:14581752-14581767]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 14580325 14584475 enh109828
Stomach
SNP sites on TFAP2A[chr19:14581752-14581767]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 14581756 rs398059580 TGCCTCAAGGGCCTCGTTGC T 5456580
chr19 14581756 rs59891980 TGCCTCAAGGGCCTCGTTGC T 5456581
Genes possibly regulated by TFAP2A[chr19:14581752-14581767]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 14583278 14586174 - PTGER1 ENSG00000160951.3 14586174 0.93 1.0 4407 17141
Expression level of Genes
Back to top
miRNAs possibly regulated by TFAP2A[chr19:14581752-14581767]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results