EnhancerDB
  1. Home
  2. TFBS
  3. STAT1[chr14:51273207-51273222]
Chromosome characteristics of STAT1[chr14:51273207-51273222]
Back to top
Enhancers possibly regulated by STAT1[chr14:51273207-51273222]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 51262797 51273375 enh15594
Prostate (PC-3) Astrocyte Bone (Osteoblast) Blood (GM12878) Placenta Lung (PC-9) Uterus Epithelial (MCF-7)
SNP sites on STAT1[chr14:51273207-51273222]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 51273207 rs142491603 T TTATTGCCACACCATCTGACA 3531528
chr14 51273207 rs6145336 T TTATTGCCACACCATCTGACA 3531529
Genes possibly regulated by STAT1[chr14:51273207-51273222]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by STAT1[chr14:51273207-51273222]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results