Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 54764145 54769895 enh30905

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 54768897 rs12432299 G A 3553526
chr14 54768903 rs539016034 GAAAGTGGTAGGAAATGAGGTCA G 3553527

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results