EnhancerDB
  1. Home
  2. TFBS
  3. IRF1[chr14:55678156-55678177]
Chromosome characteristics of IRF1[chr14:55678156-55678177]
Back to top
Enhancers possibly regulated by IRF1[chr14:55678156-55678177]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 55677319 55682170 enh3213
Skin (Keratinocyte) Colon (HCT116) Blood (Karpas-422)
SNP sites on IRF1[chr14:55678156-55678177]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 55678161 rs532492974 ATTCTTTCTTTCTTTCTTTCT A 3560051
chr14 55678161 rs768980647 ATTCTTTCTTTCTTTCTTTCT A 3560052
Genes possibly regulated by IRF1[chr14:55678156-55678177]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by IRF1[chr14:55678156-55678177]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results