EnhancerDB
  1. Home
  2. TFBS
  3. PAX5[chr14:56076540-56076559]
Chromosome characteristics of PAX5[chr14:56076540-56076559]
Back to top
Enhancers possibly regulated by PAX5[chr14:56076540-56076559]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 56064059 56082735 enh3219
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Prostate (RWPE1) Astrocyte Muscle (A673) Blood (Karpas-422) Lung (PC-9) Pancreas (Panc1) Neural Stem Cells (H9)
SNP sites on PAX5[chr14:56076540-56076559]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 56076550 rs188997431 G A 3562757
chr14 56076551 rs11271356 ACTGCCCAGCTTTTGTTGAATAGG A 3562758
chr14 56076551 rs140500950 ACTGCCCAGCTTTTGTTGAATAGG A 3562759
Genes possibly regulated by PAX5[chr14:56076540-56076559]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PAX5[chr14:56076540-56076559]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results