Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 57634442 57638908 enh68743

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 57637323 rs556082618 TTTTCCAAATGTAAAGATAGAG T 3571423
chr14 57637328 rs140584886 C T 3571424

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results