Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 57723897 57734015 enh51836

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 57729463 rs146684239 G GTGTGTATATATATACGTATATATATA 3571663
chr14 57729474 rs191388734 T C 3571664

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results