Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 57723897 57734015 enh51836

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 57731959 rs552978620 TACTCAACAAATATCTGTAGAATGA T 3571693

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr14 57670518 57735726 - EXOC5 ENSG00000070367.11 57735726 0.77 0.98 3766 13345
chr14 57735627 57756797 + AP5M1 ENSG00000053770.7 57735627 0.72 0.99 3667 13347


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results