Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 64870190 64877458 enh68756

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 64874724 rs139479330 GTAGACCAATACCCAAGATATC G 3604716
chr14 64874724 rs370851277 GTAGACCAATACCCAAGATATC G 3604717

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results