Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 71282261 71291491 enh80871

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 71289172 rs139296589 CCCCTCTCCTCCCGCTCTCTCTCGCTCT C 3642169

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results