Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 71297185 71301775 enh95476

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 71301092 rs67836004 ACACACACACACACACACACACG A,ACACACACACG 3642329

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results