Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 72540710 72544860 enh68778

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 72541142 rs528849488 T TGGCCTCAAGCAATTCTCTTGCCTTGACCTCCC 3648954

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results