Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 73312561 73325835 enh31030

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 73316596 rs570520995 TGGGTGGATCACCTGAGGTCA T 3653190

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results