EnhancerDB
  1. Home
  2. TFBS
  3. E2F1[chr14:75398586-75398597]
Chromosome characteristics of E2F1[chr14:75398586-75398597]
Back to top
Enhancers possibly regulated by E2F1[chr14:75398586-75398597]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 75394185 75403735 enh3327
Liver (HepG2) Stomach Placenta Blood (Karpas-422) Muscle (Myoblast) Muscle (Myotube) Heart
SNP sites on E2F1[chr14:75398586-75398597]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 75398591 rs532822297 C CGGGAGGCTGAGGCGAGAGGCTGAGGT 3662943
chr14 75398591 rs59168413 C CGGGAGGCTGAGGCGAGAGGCTGAGGT 3662944
Genes possibly regulated by E2F1[chr14:75398586-75398597]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by E2F1[chr14:75398586-75398597]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results